# no description, look for one in the hello() function
# CGATTGAACATTAAGTCCAATT

import sys

def main():
    hello()

    DNA=raw_input("Please, enter a DNA string (use only letters A,C,G, and T):")
    
    # Checking whether the DNA string provided by the user consists only of
    # A,C,G, and T
    check=True
    for char in DNA:
        if (char != "A" and char != "C" and char != "G" and char != "T" ):
            check = False
            break
    
    if check == True: # if DNA string consists only of A,C,G, and T

        p=raw_input("Please, enter a pattern (a substring of DNA):")

        pos1=DNA.find(p) #finds the occureence of the pattern in DNA string,
        # and returns the index of the leftmost element of the pattern

        if pos1 != -1:
            length=len(p)  # length of pattern (needed for adjustment of position1)
            pos1=pos1+length # adjusting position1
            p_inv=p[::-1] # inverting original pattern
            pos2=DNA.find(p_inv,pos1) # looking for inverted pattern starting from
            # position 2

            if pos2 != -1:
                # next two lines take a a substring in between positions 1 and 2,
                # and invert it
                DNA_piece = DNA[pos1:pos2]
                DNA_inv_piece = DNA_piece[::-1]

                # building the mutated DNA: getting the first part (not mutated),
                # attaching mutated part, attaching the tail (non-mutated)
                DNA_muttd=DNA[:pos1] + DNA_inv_piece + DNA[pos2:]

                # presenting the results to the user
                print "Original DNA sequence:", DNA
                print "Inverted pattern:",p, "and",p_inv
                print "Mutated DNA sequence:",DNA_muttd
            else:
                print "No inverted pattern,", p_inv,", is found in given DNA sequence."
                print "The DNA sequence is left unchanged"
        else:
            print "No such pattern is found in DNA sequence."
            print "The DNA sequence is left unchanged"

    else: # if the DNA string has other symbols than A,C,G, and T
        print "The string in incorrect. It has symbols other that A,C,G, or T"
        print "Exiting the program .... Have a good day!"
        



def hello():
    print "Hello!"
    print "Welcome to the program that shows one of the possible DNA mutations"

    print "You will be asked to input a DNA string (it should be composed ",
    print "of letters A,C,G, and T only). And then you will be aslo asked to "
    print "provide a pattern (any substring of DNA string)."

    print "The program then will try to locate the inverted pattern, "
    print "and if succeeds, the substring between this inverted pattern will be "
    print "reversed"


main()